Introduction: Neuropeptide Y (NPY) is a neurotransmitter that presents at high concentrations in the hypothalamus. Neuropeptide Y is one of the most abundant peptides in chicken's brain, which works as a neurotransmitter in many functions and behaviors. The first time, it was extracted from the pituitary hypothalamus of pigs. This neuropeptide stimulates appetite and affects reproductive hormones. It was showed that there is a significant association between NPY gene and growth and reproductive traits of animals. The aim of this study was to investigate NPY gene polymorphisms and their association with reproductive traits in indigenous turkeys of Iran. These traits were including total egg weight production, length of laying period, age at the first egg, and the weight of the first egg. Materials and methods: A hundred and twenty turkey hens were randomly chosen from turkey’ s breeding center of East Azerbaijan of Iran. They were recorded for the reproductive traits. The blood samples of the birds were taken from their wing veins and used for DNA extraction. DNA was isolated from each animal's blood samples using salting-out method (Miller et al 1999). A fragment of 725bp of NPY gene was amplified using designed specific primers. The forward and reversed primers were GAAGCGTACCCCTCCAAAC and CCCCTTTAAGCAGCACAGTC, respectively. PCR was performed in a final volume of 25 ml containing 2ml of DNA template, 1. 2 ml of each primer, 8. 1 ml water and 12. 5 ml master mix containing: dNTP, proofreading Taq polymerase, MgCl2, and 1x PCR buffer. Thereafter, the PCR was programmed as follows: an initial denaturation step at 94° C for 5 min, followed by 32 cycles of 94° C for 60 s, 56° C for 40 s, and 72° C for 45 s. A final extension step was performed at 72° C for 8 min. Electrophoresis of the amplicons was carried out on 1. 5% agarose gels, and the gels were visualized under ultraviolet light after 45 minutes in 85 Volt. It should be noted that PCR products were purified and sequenced by Bioneer Company. The polymorphisms of the NPY gene was identified by commercially sequencing the PCR products and aligning the sequences using BioEdit software. PopGen32 software was used to identify genotype and allele frequencies. The associations of polymorphisms or haplotypes with the traits were analyzed using the SAS GLM procedure. Multiple comparisons of Tukey’ s test were performed to find differences among means. Results and discussion: The results revealed four novel SNPs in the NPY gene, which has not been already reported in turkey. The detected polymorphisms were including T360G, C367A, T544A, and C552T. Results of statistical analysis showed that there was a significant association between T360G and total egg weight. The T allele was the favorable allele for total egg weight trait as the TT genotype significantly increased the weight of produced eggs. The polymorphism of A544T was significantly associated with egg weight and laying length. The AA genotype of A544T positively influenced both egg weight and laying length traits. Both SNPs were located in the intron region of the gene. Although intronic mutations are not capable of altering the synthesized protein structure and/or changing the function of the protein, they may affect the level of gene transcription. Additionally, it was proved that the intronic polymorphisms may affect the gene expression levels via influencing the splicing process. Several studies have already been revealed that the NPY gene polymorphism, especially on the promoter and 5'-UTR regions, affect the reproductive traits of chicken. There is another study that reported a significant association between the SNPs of intron 3 of the NPY gene with growth and body traits in cows. It has been proven that NPY neuron terminals directly end on GnRH neurons and NPY is synthesized prior to the release of GnRH. It then releases the follicular stimulating hormone (FSH) and the luteinizing hormone (LH) from the pituitary gland. It has been shown that NPY influences GnRH secretion via affecting Kisspeptin neurons, which consequently alter reproductive traits. Also, stimulating the secretion of the GnRH through the neuropeptide receptors can lead to early maturity in the chicken. On the other hand, it was revealed that stimulation of NPY neurons mediates an increase in energy intake and storage. Altering the NPY gene expression in the hypothalamus of birds resulted in changing energy status. Moreover, NPY has been shown to be a potent appetite stimulating agent in chickens. Specific NPY receptors (Y1 and Y5) have been reported to mediate NPY effects on feeding behavior in chickens. In order to continue laying eggs, turkey hens need a higher amount of available energy and nutrients. Investigations in humans also represented that polymorphisms in NPY influenced fatness in men and was linked to body weight, BMI, body fat prototype, and leptin levels (Ding 2005, Van 2006). Concentrations of NPY are prominent when body fat reservoirs are fully consumed, resulting in hunger enlargement (Kalra et al. 1991). Consequently, upon negative energy balance, NPY levels are anticipated to be elevated. In addition, NPY has been recognized as a major controller of leptin action in the hypothalamus, affecting the discharge of LH and somatotropin (Kalra et al. 1991). This study has pointed out considerable relationships among leptin and NPY SNP with vital intensification, fertility, and milk production characteristics (Clempson et al. 2010). Also, it is assumed to be the cause of augmenting body mass index (BMI) in two different Swedish statistical groups of normal and fat peoples (Ding et al. 2005). The-880I/D advocate region variant of NPY might impact body fat prototyping in non-obese Mexican Americans from Starr County (Bray et al 2000). Therefore, effect of NPY on appetite may influence the supply of nutrients and energy to be consumed for reproductive performance specially egg production traits. Conclusion: In conclusion, four novel polymorphisms were detected in intron 1 of Meleagrine NPY gene. The polymorphisms of the NPY gene may affect some of egg production traits. If these effects validate by investigating them in a larger or another turkey population, they can be considered in breeding programs of native turkey population in North-West of Iran.

Introduction: Agouti-Related Protein (AGRP) and Neuropeptide Y (NPY) are neuropeptidesthat involved in appetite control. Few studies have been done on the long-term effects of endurance training on these neuropeptides.The purpose of this study was to investigate the effect of 16 weeks of endurance training on plasma AGRP and NPY levels in Wistar rats.Materials & methods: 20 male young Wistar rats, with mean ages of 50 to 60 days and the average weight of 158±10 g were randomly divided into two groups: control (n=10) and training (n=10). Training program was Endurance training on treadmill for 50-60 min/d, 5d/wk at 25-30 m/min, which is equal to 65-85% VO2max, for 16 weeks. After 16 weeks, fasting blood sampling was conducted 24 hours after the last training session. t test was used for data analyses. Statistical significance was set at p<0.05.Findings: The results of the study indicated that endurance training with 65-85% of vo2 max causes a significant increase in plasma AGRP (p=0.001) and non-significant increase in plasma NPY levels in training group compared to control group.Discussion & conclusions: It seems that endurance training causes a negative energy balance in rats, and to compensate this negative energy balance, plasma AGRP increases significantly and plasma NPY increases insignificantly (increase by more than 23%).

Introduction and Objective: Baluchi sheep is one of the best wool breeds in Iran, it is wellknown as high tolerance breed against dry weather and lack of forage. In this study, the effects of supplementing diet with cannabis seed on NPY gene expression in heart, liver testis, back fat and longissimus muscle tissues in Baluchi sheep were investigated. NPY is one of the most important genes involved in regulating appetite and energy balance and its most notable effect is stimulating feed intake. Material and Methods: 12 Baluchi male lambs were randomly divided into two groups. The first group was fed a control diet containing 14 percent crude protein and the second group was fed a diet containing 14 percent crude protein and supplemented with 10 percent Cannabis seed. At the end of the 110 days fattening period, the animals were slaughtered and tissue samples were collected and properly frozen for RNA extraction. Total RNA was extracted from tissues and cDNA was constructed following RNA quality and quantity control. In order to approve cDNA synthesis, PCR reaction was used to amplify a fragment of β,-actin control gene with a length of 112 bp. Real Time PCR was performed to evaluate NPY gene expression. Gene expression data were analyzed by REST software. Results: The outcomes of statistical analysis indicated that the fold change of NPY gene expression between control and treatment group was significant for liver and back fat tissues (p<0. 05). Moreover, we found that NPY gene expression was 9. 82 and 1. 03 times higher in liver and heart of the lambs treated with Cannabis seed compared with the control group, respectively. In back fat, longissimus muscle and testis gene expression levels decreased 6. 46, 2. 73 and 1. 18 times between treatment and control groups, respectively. Conclusion: It may be concluded that addition of Cannabis seed to the diet affects the lamb fattening performance through the increased liver tissue activity and modifying fat tissue metabolism. Due to the fact that the NPY gene is associated with the regulation of appetite and energy balance, the effects of cannabis on the production capacity of lambs through molecular mechanisms can play a significant biological role in liver tissue.

The purpose of this study was to examine the effect of resistance exercise (RE) with different volumes on plasma PYY, NPY and Insulin concentrations in overweight young men. Hence, nine healthy overweight male students (age: 20.88±2.52 yr, weight: 99.53±14.46 kg, body mass index: 29.7±2.74 kg/m2) selected randomly and performed two RE protocol with high volume (5 set´12 repetitions at 75% of 12RM) and low volume (3 set´12 repetitions at 75% of 12RM load), in two randomized separated sessions. Blood sampling performed pre exercise, immediately after, 1, 2 and 6 hour after RE sessions. Results showed that PYY concentrations significantly increased after both protocols (p<0.05). Significant increase was also observed in NPY concentration after both protocols (p<0.05). Also, insulin concentration was significantly increased in both protocols at 1 hour after exercise compared with pre exercise, 3- and 6-hour post exercise (p<0.05). Appetite suppression after RE with high volume was higher than RE with low volume (p<0.05). Appetite rate was significantly lower immediately post RE protocols to 1, 3 and 6 hour post exercise (p<0.05). In general the findings of this study showed that volume of RE did not affect hormones concentration of PYY, NPY and insulin. However, appetite suppression after RE with high volume was higher than RE with low volume.

Purpose: Ghrelin has been shown to have antiepileptic function. However, the underlying mechanisms by which, ghrelin exerts its antiepileptic effects are still unclear. In the present study, we investigated whether neuropeptide Y (NPY) mediates ghrelin anticonvulsant effect in the brain through its Y1, Y2 or Y5 receptors.Methods: Male Wistar rats were bilaterally microinjected with ghrelin 0.3 nmol/μl/side and NPY antagonists; GR231118 (Y1 receptor antagonist), BIIE0246 (Y2 receptor antagonist), CGP71683 (Y5 receptor antagonist) or solvents (Saline, DMSO) into the dorsal hippocampus 20 minutes before ghrelin administration. Thirty minutes after ghrelin microinjection, a single convulsive dose of pentylenetetrazole (PTZ) (50 mg/kg) was injected intraperitoneally (ip). Afterwards, duration of seizure and total seizure score (TSS) were assessed for 30 minutes in all animals.Results: Intrahippocampal injection of 0.3 nmol/μl/side ghrelin decreased duration of seizure and TSS induced by PTZ. The suppression of both duration (p<0.001) and TSS (p<0.001) induced by ghrelin in hippocampus were significantly blocked by GR231118 (10 mg/ml/side), BIIE0246 (400 pmol/ml/side) and CGP 71683A (5 nmol/ml/side).Conclusion: Our findings suggest that NPY Y1, Y2 and Y5 receptors in the hippocampus may somehow mediate the anticonvulsive action of ghrelin. Therefore, it is possible to speculate that ghrelin acts in the hippocampus to modulate seizures via NPY.

Imbalance of body fluids can cause numerous problems and diseases including ascites in poultry. Therefore, identifying the mechanisms involved in controlling water intake can help to better understand the pathophysiology of related diseases. NPY is one of the neuropeptides involved in central control of water intake. When deprived of water, the mRNA synthesis of this neuropeptide increases in the hypothalamus. So, this study examines the role of NPY1 and NPY2 receptors in central control of water intake. Two series of experiments were conducted in this study. In the first and second experiments, male broiler chickens respectively received 10 μ l of Evans Blue, 20 μ g, 10 μ g, 5 μ g and 2. 5 μ g of B5063 and SF22 (receptors antagonists NPY) by ICV injection. Then cumulative water intake was measured at 90 and 180 minutes after injection. The results showed that ICV injection of B5063 (20, 10, 5 and 2. 5 μ g) resulted in reduction in water intake compared with the control group (P<0. 05), while none of the SF22 doses had an effect on cumulative water intake compared to the control group (P>0. 05). The results of these experiments showed that the effect of NPY on water intake may be conducted through NPY1 receptor.

Objective: Epilepsy is a brain disorder involving repeated and spontaneous seizures. Epilepsy is also called seizure disorder. A seizure occurs when a surge of electrical activity affects part of the brain. Seizures can have many symptoms and can last from a few seconds to several minutes. They are typically characterized by a loss of consciousness and convulsions. Childhood absence epilepsy (CAE) presents between ages 3 and 5 years and usually remits by ages 10-12 years. Childhood absence epilepsy is usually not associated with tonic-colonic seizures. Electroencephalography (EEG) shows a normal background for age and 3-Hz generalized spike and wave discharges. In this study we want to characterize the effect of stem cells for treatment the childhood absence epilepsy.Materials and Methods: In this study we selected 12 children (2-6 years old) with a history of epilepsy for more than 6 month that treatment with stem cells implantation (stem cells contain NPY, an anticonvulsant agent that exists in the healthy human brain) in tow procedures, one of them for 7weeks, and the other on after 6 months. EEG, the symptoms of epilepsy and duration are observed and notated before and after stem cell therapy.Results: In 9 patients seizures are much more under control, and 3 children only had seizures 5-10 times per day, and they last only 1-2 seconds. In all patients EEG was changed and generalized spike and wave discharges decreased.Conclusion: Plasticity of embryonic stem cells can help to repair brain cells that have been damaged by repeated seizures. Seizure disorders are characterized by the hyper excitability of different types of brain cells, meaning they are more susceptible than healthy brain cells to electrical storms.

In this research, the effect of in ovo injection of egg yolk of native Khazak chicken into the egg yolk of the commercial Ross 308 strain at prior to incubation on some metabolic-related parameters were tested in the resulting progeny. The search parameters included feed intake, feed conversion ratio, some of serum biochemical parameters, malondialdehyde concentration as well as relative expression of AMP-activated protein kinase (AMPK) and Neuropeptide Y (NPY) genes in progeny's brain tissue. To achieve this goal, 320 fertile Ross 308 eggs were equally allocated in a completely randomized design into two experimental groups, those injected with Khazak yolk (Test) and control group. Blood and tissue samples were collected at the end of experiment and evaluated for the parameters noted. Compared with the control group, Khazak egg-yolk injection resulted in a significant improvement in the feed conversion ratio as well as significant decreases in serum triglyceride, triglyceride/HDL-C ratio, relative visceral fat mass content and levels of AMPK expression in the progeny's brain. In contrast, Khazak yolk injection had no effect on the 45-day body weight, cumulative feed intake, relative brain weight, serum glucose, cholesterol and LDL-c levels but also had no effects on malondialdehyde concentration and NPY expression in progeny brain tissue. According to the results of this study, the injection of native Khazak egg yolk into the yolk of the commercial Ross 308 eggs have effectively improved the feed efficiency and reduced AMPK expression in the diencephalon region of the progeny's brain.