Journal Paper

Paper Information

Journal: یاخته
Year:2011 | Volume: | Issue:
Start Page: | End Page:



Persian Version







Information Journal Paper




 Start Page 70 | End Page 71


 Objective: Androgen is an important steroid for maintaining sperm production. The ANDROGEN RECEPTOR gene resides on Xq11–12 and consists of 8 exons, of which exon 1 contains a CAG REPEAT motif resulting in a polyglutamine stretch. In-vitro studies have demonstrated an inverse relationship between CAG REPEAT length and AR function. Many studies have examined the possible correlation between the length of the polyglutamine repeat in the AR gene and male infertility. A number of these reports suggested a link between male infertility and expansion of the polymorphic trinucleotide (CAG) repeat in the AR gene and the other reports failed to demonstrate such an association.We undertook an analysis of the CAG REPEATs in the AR gene among infertile and fertile men of BUSHEHR PROVINCE of Iran. Therefore, we conducted a case-control study of 50 patients with idiopathic male infertility and 50 fertile men. According to our results, CAG REPEAT length in the ANDROGEN RECEPTOR gene has no correlation with male infertility in BUSHEHR PROVINCE of Iran. Materials and Methods: Blood samples were collected from 50 men with idiopathic infertility and 50 fertile men. DNA was extracted from peripheral blood samples and CAG REPEATs in exon 1 of the AR gene were amplified by the polymerase chain reaction (PCR). The following primers were used: forward primer: GTCCAAGACCTACCGAGGAG and reverse primer: CCTCATCCAGGACCAGGTAG. Amplificationwas carried out in a Biorad thermal cycler 94°C for 5 minutes, 35 cycles at 94°C for 45 seconds, 63.3°C for 30 seconds, 72°C for 30seconds, and a final extension at 72°C for 10 minutes. The CAG REPEATs were analyzed using acrylamide gel electrophoresis and sequencing methods. Statistical analysis was performed with SPSS-16 program.Results: Sequence analysis indicated that the CAG REPEAT length in infertile males ranged from 17 to 27 (mean 22.8), whereas the number in fertile males ranged from 19 to 27 (mean 23.51). Differences among frequencies were calculated with T-test. P values >0.05 were considered statistically significant. CAG REPEAT expansion in the ANDROGEN RECEPTOR gene is not associated with male infertility in Bushehrian populations.Conclusion: This study was designed to investigate the hypothesis that there is an association between the length of the CAG REPEATs of the AR gene and various degrees of impaired sperm production in infertile males of Busheh province of Iran.P values >0.05 were considered statistically significant. CAG REPEAT expansion in the ANDROGEN RECEPTOR gene is not associated with male infertility in Bushehrian populations. The current study is the first to examinethis correlation in a defined Bushehrian population, and this adds to the data available for different ethnic backgrounds.



  • No record.
  • Related Journal Papers

  • No record.
  • Related Seminar Papers

  • No record.
  • Related Plans

  • No record.